Knowledge is power ,

sharing knowledge is powerful

بوسى
..
منذ 5 سنوات
اجابة  1   مشاهدة  98

التتابع التالى لقواعد فى شفرات الحمض النووى DNA لتكوين عديد البيتيد المكون لعشرة احماض امينية

3GTTAACCGAACGGTTAGATGACATTTAAGC5

اجب عن الاسئلة الاتية :

ا- اعط المعلومات الاولية لقواعد الحمض النووى الرسول m.RNA المسئولة عن ترجمة

التتابع اعلاه

ب- ماتتابع الاحماض الامينية التى سيكون عليها عديد البيتيد الناتج

(استعن بجدول الكودونات الموجود فى نهاية الكتاب )

ح- كم عدد انواع الاحماض الامينية المكونة لهذا البروتين

د- كم عدد انواع t.RNA على حسب مقابل الكودون

اجابة (1)

ا- يتم نسخ m.RNA باستخدام انزيم بلمرة m.RNA بنفس طريقة نسخ DNA

ولكن مع وجود فارق اساسى هو : اضافة (U) بدلا من (T) كمايلى :

ح- (8) فقط لان حمض ( جلوتامين ) موجود مرتين وكذلك حمض (سيرين)

د(9) فقط لوجود مقابل كودون (GUU) والخاص بالحمض (جلوتامين ) مرتين

اما حمض (سيرين) ففى هذا المثال له حمضين ناقلين لكل منهما مقابل الكودون خاص احدهما

(AGA) والاخر (AGC)

اضف اجابتك