بالعلم ترتقى الامم

أسئلة عامة

بوسى
منذ 5 سنوات
اجابة  1   مشاهدة  98

اذا كان تتابع النيوكليوتيدات فى شريط DNA كالاتى

5...........ATCAAATCTCGCAAATGA...............3

اجب عن الاسئلة الاتية

ا-اكتب تتابع جزئ m.RNA المنسوخ من الشريط المكمل ل DNA السابق

ب- ماعدد الاحماض الامينية المتكونة وعدد t.DNA المشاركة عند الترجمة لهذا الشريط

بوسى
منذ 5 سنوات
اجابة  1   مشاهدة  86

اذا علمت ان مضادات الكودونات على جزيئات t.RNA المختلفة الخاصة بالاحماض الامينية على الترتيب هى

UAC ميثونين /AAA فينيل الانين / GGG برولين

ارسم شكلا يوضح تكامل انواع RNA المختلفة لبدء انتاج شريط من عديد الببتيد على الاحماض الامينية الثلاثة على الترتيب

بوسى
منذ 5 سنوات
اجابة  1   مشاهدة  99

حدثت طفرة استبدال النيوكليوتيدات (G ) فى احد اشرطة DNA

فهل يتغير نوع الاحماض الامينية التى تدخل فى بناء البروتين المقابل من هذا الشريط

بم تفسر ذلك مع ذكر نوع هذة الطفرة

بوسى
منذ 5 سنوات
اجابة  1   مشاهدة  90

اذا علمت ان كودونات الميثونين والارجنين والفالين فى m.RNA تترتب فى التتابع التالى

(AUG - CGU - GUA ) اذكر مضادات الكودونات فى t.RNA لهذة الاحماض الامينية اكتب مضاد الكودون

فى t.RNA الناقل لهذة الاحماض الامينية

بوسى
منذ 5 سنوات
اجابة  1   مشاهدة  95

اذا علمت ان شفرة الجليسن والالانين والميثيونين على m.RNA على الترتيب هى

(AUG -GUG -GAU )

اكتب مضاد الكودون فى t.RNA الناقل لهذة الاحماض الامينية

بوسى
منذ 5 سنوات
اجابة  1   مشاهدة  106

اذا كان تتابع القواعد النيتروجينية فى احد شريطى قطعة من جزئ DNA

.CAGGTACTG................5................

3

ا-ما تتابع القواعد فى الشريط الاخر من هذة القطعة

ب- ما الدليل (او الادلة ) التى استندت علية فى تحديد تتابع القواعد الذى ذكرتة

ح-ماتتابع القواعد فى شريط m.RNA المنسوخ من الشريط المزدوج الناتج

ء-كم عدد الاحماض الامينية التى تنتج من هذة القطعة من m.RNA

بوسى
منذ 5 سنوات
اجابة  1   مشاهدة  189

التتابع التالى يوضح ترتيب القواعد النيتروجينية على احد شريطى قطعة من جزئ DNA

.T -A -T -G -T -G -G -A -T -G -A -A -T -T -............5................

ا-اكتب تتابع النيوكليوتيدات فى قطعة جزئ m.RNA المنسوخة من هذة القطعة من جزئ DNA

ب- حدد عدد الاحماض الامينية فى سلسلة عديد الببتيد التى سيتم بنائها من قطعة m.RNA الناتجة

ح-ما عدد مجموعات الفوسفات الحرة فى هذة القطعة من شريط DNA

د-ما عدد مجموعات الفوسفات فى هذة القطعة من شريط DNA

ه- ما طول هذة القطعة من شريط DNA بالنانومتر

و-كم عدد الكودونات على m.RNA المنسوخ من هذة القطعة من DNA

بوسى
منذ 5 سنوات
اجابة  1   مشاهدة  318

تعرف احد الباحثين على التتابع AAC فى شريط لجزئ m.RNA داخل النواة فاذا كان التتابع AAC

فى الشفرة الوراثية هو كودون الحمض الامينى الاسباراجين

فهل من الضرورى ان يظهر الاسباراجين فى البروتين الناتج عن ترجمة هذاالحمض النووى m.RNA

فسر اجابتك

بوسى
منذ 5 سنوات
اجابة  1   مشاهدة  98

التتابع التالى يوضح تركيب احد شريطى قطعة منجزئ DNA

5...A- T - A - C - A - C - C - T - C - A - C- T ...

5

* اجب عن الاسئلة التالية :

ا- اكتب تتابع النيوكليوتيدات فى الشريط المكمل بنفس القطعة من جزئ DNA

F- اكتب تتابع النيوكليوتيدات فى قطعة جزئ m.RNA المنسوخة من هذه القطعة من جزئ m.RNA

بوسى
منذ 5 سنوات
اجابة  1   مشاهدة  98

التتابع التالى لقواعد فى شفرات الحمض النووى DNA لتكوين عديد البيتيد المكون لعشرة احماض امينية

3GTTAACCGAACGGTTAGATGACATTTAAGC5

اجب عن الاسئلة الاتية :

ا- اعط المعلومات الاولية لقواعد الحمض النووى الرسول m.RNA المسئولة عن ترجمة

التتابع اعلاه

ب- ماتتابع الاحماض الامينية التى سيكون عليها عديد البيتيد الناتج

(استعن بجدول الكودونات الموجود فى نهاية الكتاب )

ح- كم عدد انواع الاحماض الامينية المكونة لهذا البروتين

د- كم عدد انواع t.RNA على حسب مقابل الكودون